s Sanger Sequencing - Icahn Institute - Genomics and Multiscale Biology
Icahn School of Medicine at Mount Sinai
Mount Sinai - Twitter Mount Sinai - YouTube Mount Sinai - Facebook

About

Resources Genomics Core Facility Sanger Sequencing

Sanger Sequencing

Sanger sequencing utilizes four-dye fluorescent labeling dideoxy-termination methods and a real-time scanning detector. Automated DNA sequencing is performed at the GCF using the Applied Biosystems Prism 3730xl Genetic Analyzer. This sequencer automatically performs the electrophoresis, calls the bases and archives the data. 

With the DNA templates submitted by the user, we perform the following: run the cycle sequencing reactions, purify the sequencing products, run the products on the sequencer and then notify the submitter by email when the data is ready to be retrieved. The ABI electropherogram is retrieved via website. Depending on the purity of DNA preparation and size of the template, over 800 nucleotide bases will be provided in less than 3 days (turnaround time is dependent on overall demand for the service). Clinical sequencing samples have higher priority than research samples.

Sample Submission Guidelines

Templates

The sequencing templates can be circular single- or double-stranded DNA (ex. plasmids or cosmids) or linear PCR-generated products.

Dilute DNA Sample and/or primer in water at concentrations specified below.

Submit samples in be 0.2 ml strip tubes and caps with sample numbers on the side of tube.

Note: Template and primer concentration shown are before combining the two.

 

Template Template Concentration Sequencing Primer Concentration Sample Submission (in 0.2 ml tube)
PCR Products
(<2 kb)
5 ng/Ál 4 ÁM Mix 16 Ál of template with 4 Ál primer
PCR DNA (>2kb) 25 - 50 ng/Ál 4 ÁM
Plasmids/Miniprep 50 - 100 ng/Ál 4 ÁM
Cosmid, ?, BAC, PAC DNA (10-200kb) 500 ng/Ál 40 ÁM Mix 24 Ál of template with 2.5Ál of primer

Primers

Sequencing primers can either be supplied by the user or the user can request that the GCF supply one of the following standard sequencing primers:

 

Sequencing primer name Sequence (5' to 3')
M13F TGTAAAACGACGGCCAGT
M13R CAGGAAACAGCTATGACC
SP-6 ATTTAGGTGACACTATAG
T-3 ATTAACCCTCACTAAAGGGA
T-7 TAATACGACTCACTATAGGG

Pricing

Research samples: $6/sequencing reaction

Online Submission Site

Sample information can be added one at a time or as a batch upload. For batch upload, please use the following template. Sanger Submission Template [XLSX]

Note: combined total characters of both sample name + primer name cannot exceed 16 and only alphanumeric characters and hyphen are allowed.

Once sample information has been successfully uploaded, print out final table, attach it to samples and leave samples at one of the Mount Sinai drop off points.

Go to Online Submission Site

The three "drop off" refrigerators at Icahn School of Medicine are located at:

  • Annenberg Building, Room 16-285A - drop-off box located inside a walk-in cold room
  • Atran Building, Room 2-54 - drop-off box located inside a walk-in cold room
  • Icahn Building, Room 13-02 - refrigerator located inside Genomics Core Facility

Contact Information

For more information, send an e-mail to sanger-gcf@mssm.edu.